Sentence examples for below forward from inspiring English sources

Exact(1)

The beta-actin gene was used as an internal reference, and primers were designed as below, forward primer: 5′- TGCAAAGCCGGATTCGCTGG -3′; reverse primer: 5′- AGTTGGTGACAATACCGTGC -3′.

Similar(59)

The upper hangar level opened onto a short flying-off deck, below and forward of the main flight deck.

A two-storey hangar, each level 16 feet high and 550 feet long, was built on top of the remaining hull; the upper hangar level opened onto a short "flying-off deck", below and forward of the main flight deck.

I've summarized my favorites below and look forward to profiling these individually.

Check out the track below, and look forward to the RBMA festival to take over NYC in April and May.

As Rivera was announced and his "Enter Sandman" theme began, a bullpen camera smoothly caught Rivera walking forward, below, and away in one shot.

With stocks also growing, the agency concludes, "there seems less reason for concern".Second, the market is in "contango"—meaning that the spot price is below the forward price (see chart).

Top public enterprise tech companies such as Workday, ServiceNow and Palo Alto Networks are all trading below 10x forward revenue.

Thus, an aggregate data rate of over 1.3 Gbit/s is realized with the 3-dB bandwidth of 20 MHz, while the bit error rates (BERs) for the four channels are below the forward error correction (FEC) threshold.

Two of the triple mounts were sited on a platform just below the forward end of the flight deck.

There was no island superstructure when the carrier was completed; the carrier was commanded from a space below the forward end of the upper flight deck.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: