Sentence examples for being in the small from inspiring English sources
For now, she enjoys being in the small group of Air Assault instructors, a tight group working together.
There were gentlemen in the stalls at the first night of The Importance of Being Earnest who enjoyed being in the small coterie to get the joke about bunburying.
This research was carried out in a developed country/economy setting; also, using firms that are not clearly defined as being in the small scale category.
Being in the small talk business is a benefit for me because I usually don't have the panic that others often experience when walking into an unfamiliar room with unfamiliar faces and starting a conversation.
Of all tumours, 13 (54.2%) were malignant, 3 of them being in the small intestines.
98.3% of piRNAs mapping to the Ae. aegypti tj gene contain U in their first position while 75.3% commenced with the 25 nt sequence 5' UAUUGACAACAGAAGUAACGAAUGA 3' with most variations being in the small number of additional ribonucleotides present at the 3' end.
It's in the small of the back".
If you're in the small camp, work on efficiency.
E0102-72 in in the Small Magellanic Cloud a small galaxy about 200,000 light years from Earth.
The answer was in the small print in the pack; we could film the play beforehand.
