Sentence examples similar to being designed at that stage from inspiring English sources

The possibility of proteolytic release was designed at the stage of expression vector construction.

The possibility of proteolytic release was designed at the stage of expression vector construction: the sequence coding for the protease-recognized motif (GAAAACCTGTATTTTCAGGGC: ENLYFQG, AcTEV protease) was introduced by a PCR primer between the hoc gene and the affinity motif.

Because an AC coupled instrumentation amplifier was designed at the first stage, the input signal into the opto-isolator circuit had little to no DC offset.

A fine-grained searching algorithm was designed at the second stage of TSPSO.

TCl-Db was designed at the early stages of this project, between 2003 and 2004.

The stage was designed at the behest of George Balanchine and Lincoln Kirstein, the dance company's founders, to muffle dancers' footfalls.

The system was designed in triple stages at different operative pressures.

Recently, a new International Neuroblastoma Risk Group Staging System (INRGSS), based on imaging findings, was designed to stage the patients at the time of diagnosis.

All three conditions were designed to be at a stage, which required a surgical intervention, which was supposed to be the content of the ICTs.

A Fulbright scholarship is designed for people at varying stages in their careers with terms ranging from 2 11 months.

"We need treatment and recovery residence programs that are designed to meet people at the various stages of change they arrive in".