Sentence examples for before insertion into the from inspiring English sources

For VRLA batteries with absorptive glass mat (AGM) separators, the plate group should be compressed to a definite pressure and then fastened with polymer tapes before insertion into the battery container (for both traction and stationary cells).

A membrane protein should not have a stable fold before insertion into the membrane.

For truncated constructs, stop codon was removed by PCR before insertion into the Luc-tagged vector (Primer: 5'CCTCTAGACTGGATCCAGAGACAGGCTTGAGTG3').

The sensor was automatically calibrated with precision gases under microprocessor control, as per the manufacturer's recommendations, before insertion into the esophagus.

In these cells, a single Spc110-YFP focus was observed, providing evidence that Ndc1 localizes to the new SPB before insertion into the NE.

Filters for DNA extraction were cut into 2 × 2 mm pieces with sterile scalpels in a laminar flow hood before insertion into the lysis tube.

The resulting Mascot distiller XML output is then processed with JAXB and the Java StAX API before insertion into YPED.

We evaluated the success rate of proper guidewire placement while the guidewire J-tip directed cephalad before insertion into a needle hub in ultrasound group and landmark group.

Our study showed that the incidence of unsuccessful guidewire placement was significantly lower during subclavian venous cannulation when ultrasound is used compared to landmark method even when the guidewire J-tip directed cephalad before insertion into a needle hub.

We demonstrated that the rate of unsuccessful guidewire placement was significantly lower in real-time ultrasound guided SCV cannulation compared to landmark one even though the guidewire tip was directed cephalad before insertion into a needle hub.

The cDNA was released by PmeI digestion before insertion into PmeI linearized pWPI lentiviral expression plasmid (addgene).