Sentence examples for before insertion into mice from inspiring English sources

All tissues were stored frozen at -80°C in a freezing medium (80% heat-inactivated fetal bovine serum with 20% dimethyl sulfoxide, vol/vol), thawed and washed three times with PBS before insertion into mice.

TEM specimens were heated in air at 150 °C for 7 min shortly before insertion into the TEM column.

Before e-mail, we scrawled SWAK on the back flaps and even knew arcane rules for folding the letters and notes properly -- this we learned in grade school -- before insertion into an envelope.

These batters are thawed a day or so before use, and a measured amount is scooped from the container and placed on a baking pan immediately before insertion into the oven.

Figure 4 An LCM crate equipped with AcouADC boards before insertion into its titanium housing.

A membrane protein should not have a stable fold before insertion into the membrane.

For truncated constructs, stop codon was removed by PCR before insertion into the Luc-tagged vector (Primer: 5'CCTCTAGACTGGATCCAGAGACAGGCTTGAGTG3').

The cDNA was released by PmeI digestion before insertion into PmeI linearized pWPI lentiviral expression plasmid (addgene).

The resulting Mascot distiller XML output is then processed with JAXB and the Java StAX API before insertion into YPED.

Filters for DNA extraction were cut into 2 × 2 mm pieces with sterile scalpels in a laminar flow hood before insertion into the lysis tube.

The evolutionary ancestors of the Copia, DAHLIAE, VdHAT and VdMULE TEs apparently evolved into different groups before insertion into the VdLs.17 genome.