Sentence examples for before insertion into from inspiring English sources

Exact(25)

Before e-mail, we scrawled SWAK on the back flaps and even knew arcane rules for folding the letters and notes properly -- this we learned in grade school -- before insertion into an envelope.

Figure 4 An LCM crate equipped with AcouADC boards before insertion into its titanium housing.

For VRLA batteries with absorptive glass mat (AGM) separators, the plate group should be compressed to a definite pressure and then fastened with polymer tapes before insertion into the battery container (for both traction and stationary cells).

A membrane protein should not have a stable fold before insertion into the membrane.

For truncated constructs, stop codon was removed by PCR before insertion into the Luc-tagged vector (Primer: 5'CCTCTAGACTGGATCCAGAGACAGGCTTGAGTG3').

The cDNA was released by PmeI digestion before insertion into PmeI linearized pWPI lentiviral expression plasmid (addgene).

Show more...

Similar(33)

In 1970 he produced two politically provocative projects called "Insertions Into Ideological Circuits".

But many ambassadors noted dryly that member countries were usually given the chance to discuss such recommendations before their insertion into official documents.

Before the insertion into a device, verification is performed in reference to a hash list.

During autophagy, LC3-I is cleaved to LC3-II and subsequently modified through the Atg4-dependent insertion of a phosphoethanolamine moiety before its insertion into the membrane of the forming phagophore, a double membrane required for the recycling of protein aggregates and organelles [24].

No other filter was applied to the BLAST results before their insertion into the database.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: