Sentence examples for been verified in specific from inspiring English sources

Theoretical predictions have been verified in specific models such as Boolean networks, liquid state machines, and neural networks.

Recently, the effectiveness of specific regimens for resectable gastric and/or gastroesophageal cancer has been verified in large clinical trials.

They have not been verified in any way.

While these projections from our findings seem consistent with respect to the existent literature on culture [3], [5], they are still speculations that should be verified in studies of even more specific mechanisms of cultural differences in visual processing and the impact on memory for visual details.

Although computer analysis provides predictions about what these factors might be, these predictions will need to be verified in future studies using factor-specific antibodies and purification procedures.

The stable replication of this plasmid in Dsl 9019 was verified in sub-cultures using plasmid-specific primers (pF1: cagcgaagagcaagacaa, pR1: tcatggaagcgatctcgg and pF2: ttaccggacgccgagctgtggcgt, pR2 :caggaagatgtcgttatcgcgagt).

Problems with the response format in this study may be influenced by the relatively small sample used in this study and will need to be verified in larger and broader samples before specific recommendations can be made.

The movement of blaCTX-M-15 was verified in the transconjugant using CTX-M-group 1-sPCRific PCR [ 16].

Absence of primer dimers and non-specific products was verified in every qPCR assay by melting curve analysis (temperature reading every 0.2°C from 60°C until 95°C).

To what extent the postulated cancer and treatment sensitivity of the ICS in contrast to the SOC questionnaire is cancer specific, remains to be verified in further studies.

To assess the protein expression of individual MARK isoforms we used a set of isoform- specific antibodies that was verified in a previous study [ 13] to stain hippocampus sections of several NDE and AD cases (Table  1).