Sentence examples for been validated as specific from inspiring English sources

Exact(1)

However, at the moment, a high number miRNAs have been validated as specific for sepsis.

Similar(59)

The BDI-II has been validated as a sensitive, specific, and predictive tool for measuring depression (17).

16s rDNA was PCR amplified using a set of universal primers and probe (forward primer [P891F] 5'TGGAGCATGTGGTTTAATTCGA; reverse primer [P1033R] TGCGGGACTTAACCCAACA; UniProbe CACGAGCTGACGACARCCATGCA) that have been validated as sensitive and specific for bacterial detection to the limit of 5 pg of contaminating DNA [ 20, 21].

This ELISA assay has been validated as both sensitive and specific for primary and secondary dengue infections[30].

This ELISA assay has been validated as both sensitive and specific for primary and secondary dengue virus infections [ 14, 15].

We also measured serum vitamin C concentration by High Performance Liquid Chromatography, which has been validated as a rapid an specific measurement of vitamin C [ 11].

The Major Depression Inventory has been validated as a sensitive and specific measure in paper-form [ 11], and there is no obvious reason why its use as an online tool should differ greatly, although a broader issue is the need for online validation of standard psychometric instruments.

Although many SH2 domains have been validated as drug targets, their structural similarity makes development of specific inhibitors difficult.

The gene regulatory events for two genes, DREB1A and DEAR1, in the cold-specific gene module had also been validated, as evidenced through the literature search.

Finally, we show that selected predicted target genes can be validated as functional targets of specific microRNAs in vitro.

When a technology is being validated (as opposed to a specific test), there may also be limitations related to physical parameters such as PCR fragment length or G+C content.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: