Sentence examples for been validated as sensitive from inspiring English sources

At each evaluation, a neuropsychologist conducted detailed psychological and neuropsychological evaluations that have also been validated as sensitive to the neurocognitive changes found in HIV disease.

16s rDNA was PCR amplified using a set of universal primers and probe (forward primer [P891F] 5'TGGAGCATGTGGTTTAATTCGA; reverse primer [P1033R] TGCGGGACTTAACCCAACA; UniProbe CACGAGCTGACGACARCCATGCA) that have been validated as sensitive and specific for bacterial detection to the limit of 5 pg of contaminating DNA [ 20, 21].

In transcriptomics studies, FDXR gene is known as one of the most radiation responsive markers27,28 and has been validated as a sensitive gene for dose assessment in two large scale studies on laboratory inter-comparison of gene expression5,29,30.

This ELISA assay has been validated as both sensitive and specific for primary and secondary dengue infections[30].

The mini-OQLQ has been validated as a sensitive measure of HRQL in osteoporosis patients with vertebral fracture pain.

This ELISA assay has been validated as both sensitive and specific for primary and secondary dengue virus infections [ 14, 15].

The BDI-II has been validated as a sensitive, specific, and predictive tool for measuring depression (17).

The Major Depression Inventory has been validated as a sensitive and specific measure in paper-form [ 11], and there is no obvious reason why its use as an online tool should differ greatly, although a broader issue is the need for online validation of standard psychometric instruments.

In addition the delayed recall component of the 10-word list learning task has been validated as a sensitive tool for identifying mild cognitive impairment (MCI) [ 14], which is sub-clinical cognitive decline distinct from normal ageing that does not interfere with daily life, and may affect several cognitive domains, including general cognition and executive functioning [ 15– 17].

The Functional Assessment of Cancer Therapy-Lung (FACT-L) questionnaire has been validated as a reliable and sensitive means of assessing QoL domains that are relevant to patient outcomes and includes a Lung Cancer Subscale (LCS) designed to assess lung-based symptoms.

MRI has been proposed for non-invasive detection and quantification of liver iron content, but has not been validated as a reproducible and sensitive method, especially in patients with mild iron overload.