Sentence examples for been underlined that from inspiring English sources

It has been underlined that use of crude glycerol from biodiesel processing plants for hydrogen production has many advantages over the use of other organic wastes as substrate.

It has been underlined that the power law profile with an exponent α = 0.28 overestimates the velocity profile below the mean building height, while it underestimates the profile above the building [48].

It has been underlined that microbial activity during composting is mainly due to the mesophilic microbial community, such as (bacteria, fungi and actinobacteria) which play an important role in breaking down the organic compounds to humus-like material (Finstein and Morris 1975; Herrmann and Shann 1997; Ryckeboer et al. 2003).

It must been underlined that clinical data had not been provided to our teleconsultants in order to test their genuine capacity to formulate a telediagnoses.

More recently, it has been underlined that the MRC Framework is flexible and adaptable approach, and the five phases has not to be clearly separated [ 32].

Moreover, it has been underlined that the so-called effect size (difference in means over the standard deviation) on the score scale was lower than the corresponding effect size on the latent trait scale.

It was underlined that day by the modest £97,250 paid for another horse portrait by Stubbs dated 1799.

(CTG 400 tracts were cloned into an SfiI site located within a linker sequence (TGGCCACGCGGGCCATTTAAATGGCCATTAGGGCC: SfiI sites are underlined) that was inserted between the termination codon of the β-galactosidase gene and the bovine growth hormone polyadenylation (BGH-PolyA) sequence.

It is underlined that DM, as it presently stands, lacks sound theoretical foundations.

It should be underlined that this study was not focused on technology foresight analysis (TFA).

It should be underlined that, in all cases, we did not observe graphite aggregates.