Sentence examples for been generated using mutant from inspiring English sources
Recently, new experimental data has been generated using mutant strains with impaired K+ properties and diverse K+ stimulation conditions.
The mutated model was generated using DS/Build Mutant Mutants (Discovery Studio 2.1, Accelrys Software, San Diego).
The P4R2 logos were generated using dcl2/3/4 triple mutant data.
To determine if genetic loss of p53 can rescue excessive apoptosis in the shh−/− mutant, p53−/−shh−/− double mutant animals were generated using the previously published tp53M214K mutant zebrafish [44].
A second list was generated using the same mutants but using the pSDC values instead.
The trdmt1 trm4b double mutants were generated using the trdmt1 and the trm4b-1 mutalleleseles.
The nop2a nop2b double mutants were generated using the nop2a-2 (oli2-2) and the nop2b-1 mutalleleseles.
The tatC mutant was generated using a similar approach to that used to inactivate toaD.
The mSAA3-W71A mutant was generated using the QuickChange II site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA).
The FoxO3-GFP K271R mutant was generated using site-directed mutagenesis (Stratagene) using the forward primer GCGCAGCCAAGAAGAGGGCAGCCCTGCA GACAGC.
The ndr1-1/ npr1-2 double mutant was generated using pollen from a npr1-2 plantoto fertilize flowers of a ndr1-1/gl-1 plant.
