Sentence examples for been derived from mouse from inspiring English sources

1B5 myotubes have been derived from mouse and successfully used for functional reconstitution of mammalian RyR isoforms [12], [22], [23].

Embryonic stem (ES) cells have been derived from mouse, monkey, human, and many other species, and considered as potent candidates for regenerative medicine, and unique tools for understanding of disease mechanisms and screening for effective and safe drugs[1].

Haploid embryonic stem cells (ESCs) have recently been derived from mouse parthenogenetic embryos.

In this study, new mammary cell lines have been derived from mice carrying transgenes for either the neu oncogene alone, or the neu oncogene in combination with that for S100A4.

They were derived from mouse thymus as previously described [47].

The sequence was derived from mouse PQBP1 specific siRNAs (Qiagen):GAGGAAGAGATTATTGCTGAA (SI01387120).

The global miRNA expression profile of our BASCGAP source sequences were derived from mouse BASCs [61].

It has to be mentioned that most isolates of AHSV are derived from mouse brain, since this has been traditionally the preferred virus isolation method.

Ortholog information was derived from Mouse Genome Informatics (MGI) at Jackson Lab (http://www.informatics.jax.org), HomoloGene at NCBI (http://www.ncbi.nlm.nih.gov), and Ensembl (http://www.ensembl.org).org

Because the extracellular domain of CD4-TLR4 was derived from mouse CD4, it should not directly affect the CD4-independent HIV-1 vector infection [36].

Moreover, induced pluripotent stem cells (iPSCs) are derived from mouse embryonic fibroblasts (MEF) by MET at the early stage of reprogramming [4] [6].