Sentence examples for been created by modifying from inspiring English sources

Because it is possible that a rare car may have been created by modifying a common model, buyers are smart to insist on supporting documents like the factory build sheet.

Tailor-made expression systems have been created by modifying transcription, translation, PTMs and designing synthetic regulatory networks [ 14,15 ].

Detectors H+30 and H-30 are created by modifying all subwindow positions by H0.

The layout of the website was created by modifying a CSS bootstrap template [37].

NSP3a NSP3d were created by modifying the position of amino acid residues in the h-region of NSP3.

Therefore, the watermarked image is created by modifying DC value of each DCT block of the original image.

NSP4a NSP4c were created by modifying the h-region of NSP4 by changing the position of amino acid residues or substituting residues with polyleucine or polyalanine.

Two further series of novel signal peptides were created by modifying the position of amino acids in the h-regions of NSP3 and NSP4 in order to investigate whether modification of the hydrophobic amino acid position in the h-region affected the secretion efficiency of the ATH35L protein.

Prior to subcloning the Myo7a gene, the correct frame for the fusion was created by modifying the pDsREDMonomerC1 polylinker at the XhoI/SalI site by cloning the two annealed oligonucleotides as a double stranded DNA fragment: 5'TCGAGCCTCAAGCTTCGAATTCAAAAAA G 3' and 3'CGGAGTTCGAAGCTTAAGTTTTTTCAGCT5'.

Expression constructs for producing full-length and C-terminally truncated UvrD biotinylated at the N-terminus were created by modifying pET28a-UvrD and pETDUET-UvrD1 647 pETDUET-UvrD1 647

The gas diffusion cathode was created by modifying carbon fiber paper (AvCarb P75T, 10 × 10 cm, Fuel Cell Store, College Station, TX) with a conductive, hydrophobic support layer and a carbon catalyst.