Exact(1)
Today, interest in Mahler's music -- supremely personal yet bearing universal resonances -- is at a peak.
Similar(59)
The sink sits in straight line between the two, and above is a plaque bearing a universal message: "Drottinn blessi heimilid," or "God bless this home".
It was the first time a commercial item bearing a Universal Product Code (UPC) was scanned by a cashier at the checkout.
The first thing we need is some furniture and decorations: an East German-era camping bed (£13), a battered painting I swapped for some chocolate, a free desk lamp in the shape of a heart and a wall sticker bearing that universal truth: "Home is where the heart is".
In this way, all natural bodies remain substantiae signatae, cosmically predisposed substances bearing inscriptions of universal signs.
Richard Rohr is a globally recognized ecumenical teacher bearing witness to the universal awakening within Christian mysticism and the Perennial Tradition.
The coupled thermo-mechanical finite element model of rubber linings, finite element models of thrust bearing and universal shaft petals were established respectively, and the failure reasons were discussed by simulation.
Given that the once universal billboards bearing Mr. Mubarak's portrait have largely come down, the sudden profusion of his picture held aloft by more than 100 supporters seemed alien.
The template DNA was amplified in a second round of PCR with a universal primer bearing the T7 RNA polymerase promoter sequence followed by the anchor sequence (TAATACGACTCACTATAGGGAGACCACGGGCGGGT).
Wheel bearings and universal joints require a fairly stiff grease; other chassis joints require a soft grease that can be injected by pressure guns.
The method has been optimised for LDV signals measured on bearings of universal electric motors and applied to quality control of washing machines.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com