Your English writing platform
Discover LudwigSuggestions(2)
Exact(1)
In addition, the aforementioned solutions can be used as forward model for design of experiments and to estimate the electromagnetic absorption coefficient of geomaterials.
Similar(58)
In some other related studies, WZ coding is used as forward error correction to protect the video transmission.
The atmospheric radiative transfer simulator (ARTS2) (Eriksson et al. 2011) is used as forward model to simulate atmospheric radiative transfer and calculate an ozone spectrum for the modelled atmosphere by using an a priori ozone profile.
LF402Fmix1 [sequence: GTGAAATTGYTRAAAGGGAA] and LF402Fmix3 [sequence: GTGAAATTGTCAAAAGGGAA] were used as forward primers whereas, TW13 [sequence: GGTCCGTGTTTCAAGACG] and LR3 [sequence: GGTCCGTGTTTCAAGAC] were used as reverse primers with the aim of amplifying D2 region of 28S rDNA only (Porter and Golding, 2012 and Tedersoo et al., 2015).
A set of macaque kappa oligonucleotide primers was used as forward oligonucleotide primers and reverse oligonucleotide primers [61].
Oligonucleotides 5'-TAAAGTGCTTATAGTGCAGGTAG-3' and 5'-CGCAAGGATGACACGCAAATTC-3' were used as forward primers respectively of miR-20a and U6 in the real time amplification mixtures.
The oligonucleotide 5'-GGCATCTAGCTCACCAATG-3' (nucleotides 3 to 21) was used as forward primer for amplification of a region of the cDNAs contained in Exon 2 that is common to the three mRNAs.
Following oligonucleotide primers were used as forward and reverse primers: FP: 5' CTAGCTAGCGAGCGAGTCTCTTTTCAGCCTTT 3' and RP: 5'CGGCTCGAGTATGGCGACTAATTCTCCTTGTTTT 3' The amplified PCR product was digested with Nhe1/Xho1 and inserted into Nhe1/Xho1 digested expression plasmid vector pET21c (Novagen, Madison, WI, USA).
In a first PCR, a specific 16S rDNA primer for Microcystis (CH) described by Rudi et al. [55] was used as forward primer combined with the universal reverse 23S rDNA primer ULR [54].
The oligonucleotides 5'-CGTTTTTGATACGAATTCTTGGATC-3' (nucleotides −2507 to −2483), 5'-CCTCACTTCATAAATATATCTTTG-3' (nucleotides −1284 to −1261) and 5'-CTAGTAAAATTAATTTGTTGTACC-3' (nucleotides −459 to −436) were used as forward primers for amplification of the cDNAs corresponding to mRNAs 1, 2 and 3, respectively.
For detecting the pre-mRNA fragment from the pETv5 minigene (607 bp in length), a primer spanning the deletion site of CD44 exon v4 was used as forward primer (TCATTATGACAGTTGCCACCAG).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com