Sentence examples for be underlined as it from inspiring English sources

Exact(2)

PhyloExplorer's educational potential should also be underlined as it might be particularly helpful for preparing undergraduate courses and boosting public awarenes on taxonomy and phylogenetics.

Moreover, a further fundamental aspect is worthy to be underlined, as it is likely to concern not only cancer cachexia, but the most part of palliative care dimensions.

Similar(58)

An hypothetical alteration of brain 5-HT neurotransminsion in migraine patients, probably genetically determined, was repeatedly searched in the periphery (platelets, vessels, etc)., and sex and seasons were underlined as critical variables in the interpretation of diagnostic group differences [1, 10].

Despite the heartening aspects, it has to be underlined that England were vulnerable in the absence of the injured John Terry and Rio Ferdinand.

However, it is to be underlined that follow up data could not be issued from a moderate percentage of patients.

It needs to be underlined!

If the text after that is seen underlined as well, then you did not type the closing tag correctly.

Domain V (747 nt) of the Drosophila 28S ribosomal RNA was produced using in vitro transcription (Fermentas, Germany) and a PCR fragment amplified with primers 5′ TAATACGACTCACTATAGGGGATATTAGACCTCGGTTTGGTATCG (T7 promoter sequence is underlined) and 5′TGTGCCATTGGTCCGTACCTGCGGG, as a template.

The combination of pepper spray, Swat teams and judicial torture – for that is what it was underlined for me a strain of American life that is forever present but rarely makes itself so boldly visible as it has this week.

A. Protein alignment of the PIGH protein from mammals to yeast; the two transmembrane (TM) domains, as annotated in UniProtKB, are underlined and highlighted in yellow; wild-type (WT) and mutant (MUT) bovine PIGH are presented and the deduced missing amino acid sequence - corresponding to the second TM domain and part of the cytoplasmic C-terminal domain - is boxed in grey.

Both elements are interesting; both are underlined way too heavily.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: