Sentence examples for be underlined and from inspiring English sources

That word — if — should be underlined and written in boldface type.

Once "tagged", the username will be underlined and tappable in the story.

The way shadows and light are created, but also the use of brazil-wood lakes can be underlined and put in relation with the practice of French illuminators.

This refinement in modelling objects and characters, but also in the composition and the three-dimensional representation of the scene can be underlined and put in the perspective of early Renaissance panel paintings [24].

These data could be underlined and significantly completed in terms of the time course of toxic Cd effects applying the impedance-based RTCA method in the present study.

Conversely, a few limitations of this study deserve to be underlined, and include the lack of detailed pre-ICU-admission data (for example, fluid challenge, exact time of onset of signs of sepsis).

GFP-EHD1 ΔEH 1-4388) was generated using 5′-GCCTCGAGATGTTCAGCTGGGTCAGC-3′ (sense primer, XhoI site is underlined) and GCGAATTCTCACTCCACGTCGTCGATGC (antisense primer, EcoRI site is underlined).

For expression of antisense AtYLMG1-1 gene, a genomic fragment was amplified by primers 5'-ATG theAGATCACAGAGATCTCTAATGGCA-3' (the XbaI site is underlined) and 5'-AGT GAGCtheCTTCAACAGGCGGAATAAC-3' (the SacI site is underlined).

The FKH DNA-binding domain of FoxA2 (nt 432 869) was amplified from rat genomic DNA by PCR using primers DBD-FoxA2_f (5′-GCGGAATTCCGCTCGGGACCCCAAGACGTA-3′, EcoRI site is underlined) and DBD-FoxA2_r (5′-GCGCTCGAGTCCCCGAGCTGAACCTGA-3′, XhoI site is underlined).

For overexpression of AtYLMG1-1, a genomic region containing AtYLMG1-1 orf was amplified by primers 5'-ATG theAGAATGGCCGCCATTACAGCTCTC-3' (the XbaI site is underlined) and 5'-ATG GAGCtheGTTTCAACAAAACCATTAGC-3' (the SacI site is underlined).

In a parallel approach, bgl1 was amplified with primers Bgl1-LguI-f (5′-CAGCTCTTCCTCAGTAAAGTTCCCTAAAGGGTTCATG, LguI-restriction site is underlined) and Bgl1-Eco81I-r (5′-GTCCTGAGGAAGTAAGAACGTTTGGAAATTTACTGTATTC, Eco81I-site is underlined) using pQE-80L::bgl1 as template (Schröder et al. 2014).