Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
10, 12 The arylsilane unit present in the isoindolinone product could then be transformed using standard chemical techniques to access a variety of 7-substituted derivatives.
Similar(59)
Strains were transformed using standard molecular biology protocols.
All constructed yeast strains were verified by PCR and all yeast strains were transformed using standard laboratory techniques.
The PCR product was transformed using standard methods [75] and TIF4631 or TIF4632Δ strains were selected for on Synthetic Complete (SC) (-ura) and confirmed by PCR with forward primers ∼200 bp upstream of the replaced ORF (TIF4631: CCGCGTTCTCTGTGTGCAACGGATG; TIF4632: GAGGTAAACACAGCAAACGACCAC) and reverse primers within the URA3 marker sequence (GCTTGGCAGCAACAGGACTAGGATG).
Competent DH5 α Escherichia coli (Invitrogen, Paisley, UK) were transformed using standard procedures.
For recombinant protein expression experiments, chemically competent E. coli strains BL21 (DE3), Origami 2 (DE3), and Rosetta™ 2 (DE3) pLysS were transformed using standard protocols (Novagen, USA).
Tobacco leaf discs (Nicotiana tabaccum L. cv Xanthi) were transformed using the standard protocol [ 62] and the transformants were selected on hygromycin (25 mg/L).
Yeast cultures were transformed using a standard lithium acetate protocol.
The total score and subscale scores are transformed using a standard nine point scale, with high scores indicating greater problems.
The pARTVvSP-GFP construct was transformed into Agrobacterium tumefaciens strain EHA105 via electroporation [ 77] and tobacco was transformed using a standard leaf disc method [ 78].
Each p-value obtained from permutations was transformed using the inverse standard normal transformation, and the value of p was estimated by a Pearson correlation coefficient.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com