Sentence examples for be the same sequence from inspiring English sources

Most sequences matched 16S rRNA sequences in the database with E values of 0 and were designated to be the same sequence.

The present data show a distribution of AAT very close to the proximal region of chromosome X, suggesting it might be the same sequence array.

Sequences with <1% nucleotide differences were considered to be the same sequence, which could originate from alleles of the same locus or from PCR errors (Dehara et al. 2012).

Strains BCC1616 and BCC1617 were from an outbreak of B. cenocepacia ET12 infection among CF patients that occurred in 2008 [ 15] and were confirmed to be the same sequence type as J2315 ST-288 [ 6]) by sequence analysis of the phaC, gyrB and trpB genes [ 52].

"It's the same sequence and number of movements, sometimes the same harmonic bed and rhythmic pattern.

To eliminate crystal-packing effects, all GREs used for crystallization are the same sequence, and all crystals have been crystallized in the same space group P212121 with similar unit cell parameters (Supplementary Table S1).

Clearly ({x_{n}}) is the same sequence generated by (4.1) for the map S.

As the number of source packets that can be decoded after receiving each of the three sequences is the same, sequence (1) gives the largest average packet decoding delay.

The primer pair used for real-time PCR analysis of ADAMTS5 was the same sequence reported in [12].

The infectious HpSVd-grapevine cDNA clone used for these experiments is the same sequence previously referred to as HpSVd-grapevine (AB219944, Table 1).

The T7 template sequence (5' TAATACGACTCACTATAGGCGAAAGCAGGTACTGATTGCGACAATGC 3') contains the T7 promoter region which is the first 18 nucleotides and the remaining 29 nucleotides (see the sequence underlined) are the same sequence as that of the flu template.