Your English writing platform
Free sign upSuggestions(1)
Exact(1)
In addition, morphological characters have been shown to be subject to parallel evolution and extreme reduction, resulting in a paucity of synapomorphies [ 52, 53].
Similar(59)
The English master version was subject to parallel translation into the language of choice by independent translators familiar with survey research.
In the developmental plasticity/bias account, the same mutation may appear in isolated populations, often associated with a suit of coordinated phenotypic changes, and is subject to parallel (that is, identical rather than convergent) selection.
Plasma samples were subjected to parallel N-glycoprotein extraction in a 96-well format, followed by targeted quantification of the candidate proteins by SRM.
Samples were subjected to parallel amplification of the constitutively expressed, housekeeping gene, human β-actin using the following primers: forward primer: 5′- TCCTTCTGCATCCTGTCGGC -3′, reverse primer: 5′- CAAGAGATGGCCACGGCTGC -3′.
But its banks will be subject to a parallel review by the European Banking Authority, which now coordinates among European bank regulators and in the future will work with the European Central Bank.
Similarly, GLUT-12 is thought to reside in intracellular vesicles and may be subject to translocation under parallel conditions [32].
For example, the probability of a CS and the simple-spike firing rate at the time of the instruction could be subject to top-down influences in parallel, a situation that would not require a pathway from Purkinje cells to the inferior olive, and might alter the implications for what happens in the cerebellum during motor learning.
(You might still be subject to the alternative minimum tax – a parallel tax system that basically says you have to pay at least a given share of your income, regardless of how many deductions you take – but you will not be hit by the higher marginal tax rates on earned income that Mr. Obama is proposing).
It has recently been demonstrated that protein coding regions are subject to frequent and widespread parallel evolution [ 6]; therefore we attempted to choose regions that are less likely to be subject to homoplastic effects that could result in misleading phylogenies.
Pooled libraries were subject to massively parallel sequencing using a 101 paired-end protocol on a HiSeq.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com