Sentence examples for be standardised with from inspiring English sources

Hence, the monitoring of ecological effects of GMO must be standardised with regard to parameters, methods, survey intervals and sites so that data are comparable in terms of measurement methods and, thus, can be analysed statistically and interpreted meaningfully [22].

All procedures will be standardised with care taken to preserve blinding in the event that patients do not have total amnesia.

Is there a good reason why short read aligners, which all do the same task, should not be standardised with the same interface?

If the flashlight rate can be standardised with the desired MCR, in an emergency situation, calibrated directional indicators in cars and light bars in emergency vehicles could be used as flashlight-guidance CPR devices (figure 3).

Indices are standardised with a mean of 0 and a standard deviation of 1.

The scores for BFI-S and Grit-S subscales are standardised with a mean of zero and a standard deviation of one.

In an 'A' grade 100-mL volumetric flask, 100.0361 mg of chromium (III) chloride was dissolved thoroughly and the resultant solution was standardised with EDTA.

"Once you take away all the colour coding and imagery and everything is standardised with massive health warnings, you really do de-glamorise the product".

As is generally done in the literature (Husain and Millimet 2009; Fryer and Levitt 2010; Sohn 2012; Golsteyn and Schils 2014), NAPLAN test scores are standardised (with mean 0 and standard deviation 1) by grade and domain in this paper.

Results were standardised with cane toad actin (GenBank Accession no. EL595572) by amplifying a 117 bp fragment using sense 5'- ATGACACAGATAATGTTTGAGAC -3' and antisense 5'- ATCACCAGAGTCCATCACAAT -3' primers.

All observations were standardised with respect to observation time.