Sentence examples for be searched using different from inspiring English sources

Exact(2)

The motifs could be searched using different classification of amino acids proposed in the literature.

Besides, the database can be searched using different criteria such as length, depth of the contigs (i.e. expression level), GO terms, Enzyme Commission numbers, Blast e-values, keywords, etc. or a combination of these criteria.

Similar(58)

For example, different repeat types (mono- to pentanucleotides versus mono- to octanucleotides) of different minimum lengths (12 bp and 3 repeat units, versus only 12 bp) were searched using different software.

The search was performed in August 2014 PubMed (see online supplementary file 1), Current Contents, and the Cochrane database were searched using different combinations of the following key terms: small bowel, obstruction, adhesion, children/paediatric, conservative treatment and the water-soluble contrast agent, Gastrografin.

With a simple click in UDECON, optimized deconvolution can be searched using two different methods (i.e., "Simplex method" or "Grid search") with adjustable choices of initial values or ranges for smoothness, position shift, and length correction.

The assembled contigs housed at PocilloporaBase can be searched using several different modalities.

The details of TEs can be searched using six different search criteria such as TE IDs, type of TE, chromosome, etc.

The corresponding MS data were searched using two different search algorithms – Mascot and SEQUEST - against the NCBI RefSeq human protein database 50 (N=33,832 proteins) with known contaminants.

Each genome sequence was searched using 'fuzznuc' for three different patterns based on the conserved CR sequences identified from previous studies of this element [ 5, 6, 8, 25]: TATAG [CT]GGATTAACAAAAATCAGGAC; TATAG [CT]GGATTAAATTTAAACCGGTAC; TATAG [CT]GGATTAACAAAAACCGGTAC; and TATAG [CT]GGATTAAATTTAAATCAGGAC. Square brackets will find either of the letters within them.

In the SF experiments, ten compounds were randomly selected from each of the chosen activity classes to act as the reference structure for a similarity search, with each reference structure being searched using a total of 25 different similarity measures.

Data were retrieved from the Web of Science (WOS Science Citation Expandeddatabasese; this was searched using the Boolean operator, 'OR', with different terms related to breast cancer, including "breast cancer", "mammary ductal carcinoma" and "breast tumour".

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: