Sentence examples for be sampled to enable from inspiring English sources

Exact(1)

PE may be an emerging genetic defect in the Holstein population worldwide and cases should be sampled to enable genetic mapping of the gene possibly underlying the disease.

Similar(59)

Staff training, compliance with PPE use, and the decision to slaughter flocks from the site only after a sufficient number of birds were sampled to enable detection of a low infection prevalence and at a 99% confidence level resulted in no further reported infection of workers during the processing of all flocks from the site over 10 months.

Fluorescent CountBright counting beads (Invitrogen, Carlsbad, CA) were added to samples to enable determinations of absolute cell numbers, and flow cytometry was used to evaluate changes in PI staining and to quantify cell death.

Fluorescent CountBright counting beads (Invitrogen, Carlsbad, CA) were added to samples to enable determinations of absolute cell numbers, and changes in PI staining were used to quantify cell death.

HIV/AIDS services included in the study-all of which were supported by Global Fund HIV/AIDS grants-were sampled purposively to enable NGO and government providers to be compared in each location.

At the end of the assay, succinate (10 mM) plus cytochrome c (10 μM) were added to the sample to enable respiration of contaminating mitochondria or broken mitochondrial membranes, which could not respire when glucose plus pyruvate were the substrates (because they lack the tricarboxylic acid cycle).

After incubation, the cells were fixed on both samples to enable SEM imaging.

One main driver of these networks (except the Clinical Pharmacogenetics Implementation Consortium) is to pool enough samples to enable robust study design with high statistical power.

Anti-human CD16 PC5-conjugated antibody (Immunotech, Marseille, France) was also used in all samples to enable gating on the PMNL population.

Standard curves were generated using previously generated samples to enable normalization to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH; forward primer ACCCCTTCATTGACCTCAACTACATG; reverse primer CCTTCTCCATGGTGGTGAAGAC) using the Pfaffl method as described elsewhere [ 37].

In hind sight quality of life could have been measured and explored in both samples to enable a direct comparison across both populations of CP and non CP children in the age group.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: