Suggestions(1)
Exact(1)
Many roller coasters will be run forward for most of the day and run backward at a certain hour.
Similar(58)
A motion picture of two billiard balls colliding, for example, can be run forward or backward with no clue to the proper time direction of the event.
For the period 2001 2010, the LUCAS model was run forward in time using the LCT rates from the 1992 2001 period.
For post processing, the filter is run forwards and backwards, followed by a smoothing operation.
This technique's main flaw is that it assumes a steady state tropical cyclone which undergoes little structural change with time, which is why it is only run forward for 24 hours into the future.
Players were given the following standard instructions: "Run forward for three steps and land with one foot on the force plate", "Jump as high as possible and simulate shooting a basketball".
Multivariable Cox regression was run using Forward Wald method to identify best independent predictors of death.
Polymerase chain reaction (PCR; 25 μL) containing 2 μL first-strand cDNA (1 10 dilution), 12.5 μL of SYBR Green PCR Master Mix Applied Biosystemss, Warrington, UK), and 0.3 μM each of forward and reverse primers were run for 40 amplification cycles in an ABI PRISM 7700 Sequence Detection System (Applied Biosystems).
The SPKF is run in the forward direction on the interval to compute the forward posterior estimates.
The GPUs are run in parallel for generating the MC-simulated forward projections.
PCRs for the mouse Notch4 gene were run in parallel (forward CTGCACCTAGCTGCCAGATTC and reverse CTGTCTGCTGGCCAATAGGAG).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com