The phrase "be produced by endogenous" is grammatically correct and can be used in written English.
It means that something is created or formed internally, within the body or system. For example: - Many hormones are known to be produced by endogenous processes in the body. - The disease was found to be produced by endogenous factors, rather than external influences. - The artists' works were believed to be produced by endogenous creative inspiration, rather than outside influences.
During storage and transport of this liquid mixture, inhibitory compounds like acids or alcohol might be produced by endogenous flora.
The cDNA sequences (meaning only sequences derived from the mature RNA) from each of the 99 genes (Supporting Information S1) were first analyzed for potentially active sequences as might be produced by endogenous DICER.
Promotional pressure on initiated cells can be produced by endogenous factors but also by the chemical itself.
9 It is possible that such peptides could bypass tolerance because peptides bearing C-terminal citrullines would not be produced by endogenous human PADs, such as PAD2 and PAD4.
DSBs are caused by radiation and platinum compounds based chemotherapy but also could be produced by endogenous damage, such as that caused by reactive oxygen species and collapsed replication forks.
The cellular oxidative stress that contributes to the aetiology of cancer is produced by an endogenous generation of ROS that arises from two main sources: the mitochondria and the NAD(P H oxidase (NOX) system (Dröge, 2002).
A 750 bp control band was produced by amplification from the endogenous PrP gene using PrP-S and the reverse primer (PrP-AS: 5' CCTCTTTGTGACTATGTGGACTGATGTCGG 3').
The superoxide anion is produced by energy transfer from several endogenous UV-absorbing chromophores including NADH−/NADPH, tryptophan, riboflavin, or transurocanic acid (Rittié and Fisher 2002) in the presence of molecular water present within the cell.
Endogenous NO is produced by the constitutive isoforms of NO synthase, endothelial nitric oxide synthase (eNOS) and neuronal nitric oxide synthase (nNOS).
The exogenous AID was produced by transfected Phoenix cells, and the endogenous AID came from mitogen-and IL-4-stimulated spleen cells from BALB/c mice.
Endogenous NO is produced by nitric oxide synthase (NOS) from the substrate L-arginine.
