The biosurfactant produced by Cryptococcus sp. YLF was partially characterized as glycolipid based on the estimation of macromolecules, TLC and IR analysis.
Though F5 has been partially characterized as kaempferol 3- O-rhamnosylgentiobioside [ 12], our data indicates that it is actually kaempferol 3- O-rhamnopyranosyl(1→2 -[glucopyranosyl-(1→2 -[glucopyranosyl-e] by H and C NMR survey.
The A. acetabulum EFL was partially characterized as part of an EST survey [ 13], and to improve the resolution of its phylogenetic position we characterized the 5' portion of the gene by amplification from a cDNA library using the specific primer TTCCGACCGGCACGGTTCCAATTCCG and the 5' degenerate EF-1α primer AACATCGTCGTGATHGGNCAYGTNGA.
CAMP factors have been partially characterized in streptococcal species as co-hemolsyins and pore-forming toxins [ 46].
This validation process is partially characterized by the uncertainties associated with the modeling effort as well as the experimental results.
APX genes have been partially characterized in some plant species such as spinach (Ishikawa et al. 1995,1996,1998), cowpea (D'Arcy-Lameta et al. 2006) and eggplant (Lin et al. 2007).
Nine T. vaginalis cathepsin L-like proteinases: TvCP1, TvCP2, TvCP3, TvCP4, TvCP4-like, TvCP12, TvCP25, TvCP39 (TvCPT), and TvCP65 have been partially characterized [ 7, 27, 33, 34] as virulence factors.
108, a newly isolated strain, was recently characterized as a producer of two polyene macrolide antibiotics (rimocidin and CE-108), and the biosynthetic gene cluster was partially characterized.
Radioresistance has been partially characterized for K. radiotolerans (Figure 3).
The identity of unlinkase is unknown, but the activity has been partially characterized.
