Sentence examples for be on the reverse from inspiring English sources

Exact(2)

And why might a spouse not be on the reverse mortgage loan?

If you're a couple with plans to take out a reverse mortgage — and it really ought to be a last resort, only for those who can't make ends meet any other way — both of you ought to be on the reverse mortgage so you don't end up in this predicament.

Similar(58)

The genes, Mup1, Mup2, Mup18, Mup24, Mup25 and Mup26 are 82 94% identical at the cDNA level and all but one (Mup2) is on the reverse strand (fig. 1, 2A).

As an example, the word w= CATAAT might be bound by the same transcription factor as the words CTTAAT and ATTATG, the former having one substitution, the latter being on the reverse strand.

63 ORFs and the tRNA are coded on one strand (designated forward) and 7 are on the reverse strand.

The consent form was on the reverse of the questionnaire.

indicates the coding sequence is on the forward sequence, while – indicates the coding sequence is on the reverse sequence.

Although the pseudogene is specifically expressed in the same tissue as TG, the RP coding frame is on the reverse strand of the TG gene.

For ANGPT4 the 5'-biotin modification is on the forward primer, whereas for PGRMC1, PRSS21 and RGS14 the 5'-biotin modification is on the reverse primer.

PRDM5 is on the reverse strand and the primer and probe sequences are as follows: F: 5′AAAACTAAACAAAAACGAAAACGCA; R: 5′GGTTTTAAATTCGGAGGTTCGC; Probe: 5′ 6FAM-CGCGCCGAAACTAAAAATACTAACG–BHQ1.

Notably, EMSA performed with hemimethylated oligonucleotides showed that the methylated C recognized by hZFP57 is on the reverse strand of the DNA target (Fig. 2B lanes 3 and 4).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: