Sentence examples for be marked using the from inspiring English sources

Germ cells can disappear by sloughing, where they may be seen in the lumen of the epididymis (Fig.  3M versus 3N), and/or by apoptosis which can be marked using the TUNEL assay (Fig.  3J).

The silicon nanocrystals were marked using the freehand selection tool in ImageJ [17].

The facial axis of each tooth crown (FACC) was marked using the "section" tool, in all cases making sure that the C-plane was aligned correctly.

It should be noted that, in Fig. 6a, the shear cracks are marked using the red colour while the blue colour is used to denote the boundaries and the tensile cracks.

It should be noted that, in Fig. 4b, tensile crack is marked using the red colour while the compressive crack and the boundaries are denoted using the blue colour.

The 3′ end of the IME-EF4 genome was marked using the primer P1 (5′–CTCTAGTTTGTTGCGTGCGTAAATC–3′).

The 5′ end of the IME-EF4 genome was marked using the primer P4 (5′–AGGTACGGACCGCAATGGGTTGGGA–3′).

PCR duplicates were marked using the program MarkDuplicates, which is part of Picard.

When key characteristics were identified, they were marked using the object creation tool.

In short, the peripheries of lesions were marked using the Dual Knife (KD-650 L; Olympus).

Duplicate sequence reads were marked using the Picard Suite (v. 1.117) MarkDuplicates (http://broadinstitute.github.io/picard/).github.io/picard/