Sentence examples for be made with mutations from inspiring English sources

A series of mutants would be made with mutations to the operator sequence so as to produce a series of weaker repression circuits.

Similar observations were made with mutations impinging on IIS activity (e.g., PKB; Figure 7 figure supplement 4).

Those studies are all performed on DNA and no comparison is made with mutations at RNA and how the mutations can interplay with RNA expression and transcriptome network and pathway regulation remains a question.

Using optimized conditions, point mutations can be made with such high frequencies that they can be found without selection.

Point mutations were made with QuikChangeII kit (Stratagene).

Point mutations were made with the QuikChange Kit (Stratagene).

Point mutations were made with the Stratagene Site Directed Mutagenesis kit.

Several site-directed mutations were made with the goal of understanding the role of H-bonds from conserved Ser and Tyr in different organisms.

The msl1 L940X mutation was made with the primer 5' CAAAACTCGAGCTAAGGATCCAGCGCAACCAAC 3' instead of MSL1CTR.

Few studies involving small groups of subjects show increased mutagen sensitivity in irradiated peripheral lymphocytes of BRCA1/2 mutation carriers compared with healthy controls, but the implication of the BRCA mutation was not appreciable in other studies when the comparison was made with BC patients without a BRCA mutation, suggesting a major role of cancer status in mutagen sensitivity.

The Kinase Dead Sgk1 (SgKD KD ) with a point mutation (K127A) and Constitutively Active Sgk1 (Sgk1 CA ) with a point mutation (S422D) were made with QuickChange II XL Site-Directed Mutagenesis Kit (Stratagene).