The enlisted crew spaces were located forward in the upper deck, and were cramped and unhygienic.
One was located forward, and two were placed in a superfiring pair aft.
One turret was located forward, and two were placed in a superfiring pair aft.
One was located forward, and two were placed in a superfiring pair aft, all on the centerline.
It only occurs when the robot's centroid is located well forward in its body, and the robot is acts on by a large downward acceleration.
Boudewijn Zenden disappointed on the left and while Pennant was prominent on the other wing he did not devise many openings, partly because there was just one outright forward to be located, in the form of Kuyt, before the introduction of Peter Crouch.
(i) The y-axis (back-front) that shows time of development, as early and late developmental stages are located in backward forward of the landscape, respectively.
The primers were designed to amplify the exon 2 of hMYH gene, where the T/A haplotype was located in: forward, 5'- AGCTATCACCCTTGGAAGGC -3', and reward, 5'- GTCTTGATACGTATCACAATCC -3'.
The results from horizontal damage location indicate that the crushed region of the impacted vehicle is located mainly in forward of C-pillar in real-world nearside impact crashes; there are only a few possibilities in rearward of C-pillar.
Additionally, at KMMH16, the synthetic waveforms generated from Area 2 overlap those from Area 1 because KMMH16 is located in the forward direction of the rupture propagating from Area 1 to Area 2. This forward directivity is expected to have caused the strong ground motions at KMMH16 and its surroundings.
