Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
Our tests have shown that this is sufficient to allow the OCT probe to be inserted together with the nasendoscope housed within the endosheath, the camera providing guidance as the tip is progressed through the nasal cavity and flexed around the contour of the soft palate and nasopharynx to visualize the larynx below.
Similar(59)
The restriction site in the 3' UTR into which the IRES-CreER/TetR/FNF cassette was inserted, together with the sequence of ten nucleotides on each side of the insertion sites are as follows.
The loxP flanked neomycin resistance - thymidin kinase gene (neo-tk) selection cassette was inserted together with a 141 bp wt cDNA fragment of the β1 integrin gene coding for the entire cytoplasmic tail of the β1 integrin chain including the stop codon, into exon 15, just behind and in frame with the transmembrane coding region.
Furthermore, the healing of endosseous implants was not improved when those were inserted together with OCHS [ 21].
A moist chamber was made in a Petri dish where the cover slip was inserted together with a small plastic vial containing about 1 ml of 2% aqueous osmium tetroxide.
The human point mutation T5M, which leads to a substitution of a threonine by a methionine residue at position 5 of the Cx30 protein, was inserted together with a SphI restriction site via PCR mutagenesis into the corresponding mouse gene, Gjb6 (Fig. 1A and B).
c Both membranes and side holes are inserted together, resulting in the negative phase velocity.
The prostheses were then inserted together with cement and compressed axially.
The next knotless anchor was then inserted together with the tape through the infraspinatus tendon and into the valley of the Hill-Sachs defect.
The eGFP gene was removed by SpeI/HindIII digest and a LoxP adaptor molecule with NheI (5') and XbaI (3') compatible ends (CTAGCGGGGGCGCCGGGATCGATATATAACTTCGTATAGCATACATTATACGAAGTTATTTAATTAAGGGAAGCTTGGGT) inserted together with the NheI/HindIII fragment from phrGFP-N1 (Clontech) to generate pLoxPhrGFP.
Pronunciation guides or audio clips may be inserted into slideshow presentations together with pictures or videos showing the meaning of the terms or parts of the term and uploaded online for the student's future reference.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com