be forwarded back

USAGE SUMMARY

The phrase "be forwarded back" is not correct in standard written English.
It is generally used in contexts where information or items are being sent back to a previous sender or location, but the phrasing is awkward. Example: "Please ensure that the documents be forwarded back to the original sender."

⚠ May contain grammatical issues

Science

Wiki

News & Media

Human-verified examples from authoritative sources

Exact Expressions

1 human-written examples

Hence, the data packet will be forwarded back to the initial location from where the announcement message was sent, and then chases the route that Des passed to finally catch it up.

EURASIP Journal on Wireless Communications and Networking

Human-verified similar examples from authoritative sources

Similar Expressions

59 human-written examples

Then the packet is forwarded back in the perimeter mode similar to that in GPCR.

EURASIP Journal on Wireless Communications and Networking

In our protocol, the energy of a node w u j ) is considered when the RREP packet is forwarded back.

EURASIP Journal on Wireless Communications and Networking

Any data generated at Tier-2 sites is forwarded back to Tier-1 centers for archival storage.

Journal of Big Data

If the vehicle cannot find an available next hop during the period, the packet is forwarded back to the last junction.

EURASIP Journal on Wireless Communications and Networking

If there are no more D i nodes, the packet is forwarded back to the node A and the data transmission is resumed along the borderline of the network.

EURASIP Journal on Wireless Communications and Networking

The position of the cards in their pile on the stack should be: Forward, back, forward, back, back.

WikiHow

In the first scheme (AF), the received signals at both relay nodes are amplified and forwarded back to terminals and.

EURASIP Journal on Wireless Communications and Networking

For Pygo1, the genomic sequences used for PCR were: 5' forward, GTGAAGGAGAGATGGATAAGTATG; 5' back, TAGACCCTAACCACCTACAAG; exon forward, GGTTAGGGTCTATGTGCTGG; exon back, TCACCAAATCTCTGTTCTACAC; 3' forward, TGTGTAGAACAGAGATTTGGTG; 3' back, CAGTGAAGAAAGAGGGTCAG.

BMC Biology

Therefore, these events do not contribute to image noise in the object because they are not being forward and back projected over this object.

EJNMMI Physics

All materials were forward and back translated in each participating language.

BMC Public Health

Expert writing Tips

Best practice

Instead of using the awkward phrase "be forwarded back", opt for clearer and more common alternatives like "be sent back" or "be returned" for improved readability.

Common error

The phrase "be forwarded back" is often redundant because "forwarded" already implies direction. Using "back" in conjunction with "forwarded" can make the sentence sound awkward and less professional. Choose a single, clear verb like "returned" or "sent" instead.

Linguistic Context

The phrase "be forwarded back" functions as a passive construction indicating the action of returning something to its origin. Ludwig AI confirms that this phrasing is awkward and advises using alternatives. The primary function is to describe the redirection or return of an item or information.

Expression frequency: Rare

Frequent in

Science

67%

News & Media

17%

Wiki

16%

Less common in

Formal & Business

0%

Encyclopedias

0%

Reference

0%

Ludwig's WRAP-UP

In summary, while the phrase "be forwarded back" is understandable, it is generally considered awkward and redundant in standard English writing. Ludwig AI analysis indicates that more direct and common alternatives like "be sent back" or "be returned" are preferred. The phrase appears in varied contexts, primarily in scientific and technical domains, but its infrequent and awkward usage makes it less suitable for professional or formal communication. Using alternatives will improve clarity and readability. The examples provided underscore that simpler phrasing is often better. Ultimately, opting for clearer alternatives enhances the quality and precision of your writing.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

be sent back

Replaces "forwarded" with "sent", providing a more common and direct way to express the action of returning something.

be returned

Offers a simple and widely accepted alternative, directly indicating that something is going back to its origin.

be routed back

Substitutes "forwarded" with "routed", suitable when describing the redirection of data packets or network traffic.

be directed back

Replaces "forwarded" with "directed", indicating a deliberate action of sending something in the reverse direction.

be transmitted back

Emphasizes the act of sending information or signals back to a source, often used in technical contexts.

be relayed back

Suggests that information is being passed back through an intermediary, rather than directly.

be redirected

Focuses on the act of changing the destination of something to its original location.

be reverted

Implies a return to a previous state or condition, suggesting a reversal of a process.

be shipped back

Applies specifically to physical items being returned, often used in logistics or commerce.

be mailed back

Refers to the act of sending something back through postal services.

FAQs

What is a better way to say "be forwarded back"?

More natural alternatives to "be forwarded back" include "be sent back" or "be returned", which are clearer and more commonly used.

When should I use "be sent back" instead of "be forwarded back"?

Use "be sent back" in most contexts where you want to indicate that something is being returned to its origin. It's a more direct and less awkward phrasing than "be forwarded back".

Is "be forwarded back" grammatically correct?

While not strictly ungrammatical, "be forwarded back" is considered awkward and redundant. It's better to use clearer and more concise alternatives like "be returned".

What's the difference between "be forwarded back" and "be relayed back"?

"Be relayed back" implies that information is passed back through an intermediary, while "be forwarded back" is intended to mean simply sending something back. However, given the awkwardness of "be forwarded back", it's better to use phrases like "be sent back" or "be returned".