Sentence examples for be discarded for further from inspiring English sources

The problematic arcs determined should be discarded for further analysis.

While Psy2 and Psy3 are not associated with seed carotenoid content in other grasses (reviewed by [ 82]) and thus, they may be discarded for further analyses, the rest of the genes might be still useful for durum wheat studies.

The pixel is discarded for further analysis if either constraint is not met.

Most of the sequence reads do not show SNPs between the parents and therefore were discarded for further analysis on AI.

Next, the Illumina adapter sequences (5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG) and (5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT) were removed using the fastx_clipper, which is part of the FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). Reads that were <32 bp in length <span class="lh lhl">were discarded for further analyses.

However, as discussed in [21], such kind of error seldom appears in natural images (about 1% of the image blocks have truncation errors), and any block with pixels having luminance value of 0 or 255 is discarded for further analysis.

The LN emPAI) comprise values between −2.5 and 23; however there were only 4 proteins between 14 and 23 values and they were discarded for further analysis.

Animals with plasma corticosterone concentrations >150 ng/ml (i.e. the normal value of the daily peak) at T = 0 min were discarded for further data analysis.

Primers with efficiencies ≪ 87%% were discarded for further studies.

Too short sequences (length < 100) with high quality (phred QV > 20) were discarded for further analysis.

All GO categories containing less than 20 genes were discarded for further analysis.