Sentence examples for be derived from mouse from inspiring English sources

Induced pluripotent stem (iPS) cells can be derived from mouse somatic cells via the ectopic expression of four defined factors, Oct4, Sox2, Klf4 and c-Myc (also known as Yamanaka factors) [1].

Together, these data confirmed the identity of these cell lines as XEN cells and demonstrated that they were not contaminated with ES cells or any other pluripotent cell type that can be derived from mouse blastocysts.

They were derived from mouse thymus as previously described [47].

The sequence was derived from mouse PQBP1 specific siRNAs (Qiagen):GAGGAAGAGATTATTGCTGAA (SI01387120).

The global miRNA expression profile of our BASCGAP source sequences were derived from mouse BASCs [61].

1B5 myotubes have been derived from mouse and successfully used for functional reconstitution of mammalian RyR isoforms [12], [22], [23].

It has to be mentioned that most isolates of AHSV are derived from mouse brain, since this has been traditionally the preferred virus isolation method.

Ortholog information was derived from Mouse Genome Informatics (MGI) at Jackson Lab (http://www.informatics.jax.org), HomoloGene at NCBI (http://www.ncbi.nlm.nih.gov), and Ensembl (http://www.ensembl.org).org

Because the extracellular domain of CD4-TLR4 was derived from mouse CD4, it should not directly affect the CD4-independent HIV-1 vector infection [36].

Moreover, induced pluripotent stem cells (iPSCs) are derived from mouse embryonic fibroblasts (MEF) by MET at the early stage of reprogramming [4] [6].

Like MDCK cells, both of these cell lines are derived from kidney: one is derived from mouse kidney, and the other is the human renal leiomyoblastoma cell line, G-402.