Sentence examples for be constructed from published from inspiring English sources

Exact(1)

We included studies in the meta-analysis if 2×2 tables could be constructed from published or requested data.

Similar(59)

A phylogenetic tree was constructed from published sources (Figure S1).

The model is constructed from published crystallographic and microscopic structures reported by several groups over the last 30+ years.

PAI-1 primers were constructed from published sequences of the rat genome (Genbank accession no. M24067 (Brudzinski et al, 1990) PAI-1sense: tttgggaaagggttcgcttc PAI-1antisense: agtcgttgatgatgaatctgg, intron spanning).

A 17-node logic-based model of the Th regulatory network was constructed from published literature and simulated under all combinations of initial node states until logic steady states were achieved.

Recombination maps of ancestral species can be constructed from comparative analyses of genomes from closely related species, exemplified by a recently published map of the human-chimpanzee ancestor.

But many narratives can be constructed from a videotaped statement.

According to Silverstein, these can be constructed from nanotubes.

It may be constructed from parts of West's psyche, for sure, but it is also constructed by him.

Dimensions of the design space were constructed from previously published forestry inventory data and consisted of two stand condition factors, three site condition factors, one economic condition factor and one silvicultural planning factor.

The N. annulata and C. hookeri transcriptomes were constructed from previously published methods [ 31] and consisted of 276 K reads from eight individuals and 235 K reads from six individuals, respectively (NCBI SRA submission SRA061479 & SRA061480).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: