Sentence examples for be conserved within these from inspiring English sources

The overall organization of RickA [6], [7] was found to be conserved within these 12 rickettsia species.

This suggested that the binding between BoNTs and MREs may be conserved within these consensus segments [ 122].

This region would have less flexibility to mutate and, therefore, be conserved within the families.

Such words are said to be conserved within the gene family.

Additionally, the alternate splice donor appears to be conserved within the Cx.

The DRs are conserved within these three loci with a sequence of 5'- TTTCTandCthereGTGCGGCAGTGAAC-3', and there is a truncated DRs in the 5' end of each CRISPR locus with the sequences of 5'- TGCCTGTGCGGCAGTGAAC -3', 5'- TAAGCTGCCTGTGCGGCAGTGAAC -3' and 5'- GCTGCCTGTGCGGCAGTGAAC -3' for YPa, YPb and YPc, respectively.

The boxed NLS sequence is conserved within these species.

Genes are conserved within these modules in a way that is inversely proportional to evolutionary time, with two modules (those related to growth and stress-response functions) being more conservative than the other three.

Many of these features are conserved within the Pezizomycotina.

All of these residues were conserved within the two apple ANTs.

These proteins are conserved within the phiCbK-like phages but otherwise do not have any homologs in the NCBI database detectable by BLASTp.