Sentence examples for be changed to generate from inspiring English sources

Another key behavioral parameter of HS algorithms is the mutation rate (R m ), which determines what proportion of the variables contributing to the existing HM solutions should be changed to generate new slightly modified solutions to be evaluated.

Although numerous tuning parameters can be changed to generate datasets of different sizes and complexity in the software, we kept the default tuning parameters controlling the complexity aspects and only changed the ones controlling noise and the size of dataset being generated.

In IPv6 case, the number of bits is changed to generate same data.

Brightness and contrast settings were changed to generate final image and were applied equally to entire image.

For cost efficiency, four PCR primers were used, of which only one is changed to generate a new P U6:: sgRNA template.

The siRNA target site in PCNA_WT was changed to 5′AATAGAAGACGAGGAGGGT3′ to generate the RNAi-resistant plasmid, PCNA_R.

The ATR expression plasmids (ATR_WT and ATR_KD) were gifts from Dr Stephen J Elledge (Cortez et al., 2001) and the siRNA target site was changed to 5′TACCCGTCTTCTCAGAATAGCTGCA3′ to generate RNAi-resistant plasmids ATR_R and ATR_KDR.

Process parameters were systematically changed to generate various plasma conditions and thus to identify key factors affecting the methane activation.

A second set of data was simulated in which only the fixed effect of age was changed to 9 years to generate lactation curves that on average had a higher peak and a less persistent tail (HPLP).

FLAG-tagged SUMO loss of function SnoN (EdA) in which Glutamates 52 and 385 were changed to alanines was generated by a PCR-based approach.

A mutant NIa gene in which Asp81 in the catalytic triad was changed to Ala was generated by a PCR mutagenesis.