Sentence examples for be assessed only on from inspiring English sources

This can be assessed only on a case-by-case basis.

After a critical review of the available data, we conclude that the potential carcinogenic risk of nanomaterials can currently be assessed only on a case-by-case basis.

Variations in the glycoform ratio could be assessed only on the TH because the glycoform ratio, as well the electrophoretic mobility, is affected by NaPTA enrichment [14].

This last assumption couldn't be assessed only on the basis of RTs examination.

In two patients (#5, #12) with stable signal patterns on T1WI, signal changes could be assessed only on T2WI.

Some of these parameters can be assessed only on whole joints, which are commonly available in the animal models but not appropriate for humans.

The primer sequences for both CCL2 (CTAAGCTTCCAGCATGAAAGTCTCTGG and GTGAGTGTTCAAGTCTTCG) and β-actin (CGTGACATTAAGGAGAAGCTGTGC and CTCAGGAGGAGCAATGATCTTGAT) spanned at least one intron to ensure quantitation was assessed only on amplified cDNA.

Second, APACHE II score was assessed only on the day of ICU admission and may not really reflect the dynamics of critical illness and treatment response.

In the actual code formats, based on the partial reliability factors γ, reliability is assessed only on a YES-NO basis, in the same way as it had been in the working stress format.

Patients for whom RECIST progression was assessed only on clinical tumour target (e.g., supra-clavicular lymph node) were considered to have symptomatic PD.

Due to a lack of further tissue, apoptotic marker cleaved caspase-3 and neo-angiogenesis marker CD34 were assessed only on post-treatment tissues.