Sentence examples for be assayed in real-time from inspiring English sources

Exact(1)

Depending on the exact study set up and research questions, samples can be assayed in real-time, implicating assay variation between follow up time points of each single volunteer, or all longitudinal samples from a volunteer can be analysed in a single assay to minimize inter-assay variation and theoretically increase assay sensitivity.

Similar(59)

Inflammation can be assayed in real time using transgenic fish expressing fluorescent proteins in leukocytes or by histochemical assays in fixed larvae.

No viral loads were assayed in real time.

The control sample was assayed in each real-time PCR run to ensure consistency.

Relative levels of target gene transcripts were assayed in triplicate using real-time qRT-PCR with SYBR Green reagents and a StepOne Plus PCR system (Applied Biosystems).

5, 13– 17 All sample pairs were assayed in duplicate using the MX3000P real-time polymerase chain reaction system (Stratagene, Cedar Creek, TX).

Subsequently, 1 μl from each reverse transcription reaction was assayed in a 20 μl singleplex reaction for real-time quantitation with the PCR 7500 Fast System Applied Biosystemss).

ChIP genomic DNA samples were assayed in triplicate by PCR using an iQ5 real-time PCR system (Bio-Rad) and primer sets that cover the following FOXM1 promoter regions: FOXM1p-779 (−779 TGCTGGGATTACAGGCGTGAGCTCCCGAAGCCAAGCCTTCGGCCAAGCCTTCGG; FOXM1p-312 (−312 to −312), GTGTCGCCTGGCGTGACCAGC, AAGAAGTGGCCGTGGGGCCGG.

The expression of 12 selected genes, such as WRKY22, WRKY53, SAG12, SAG20, was assayed in seven samples by SYBR®Green Real time PCR (TOYOBO, Japan) with the SYBR®Green Realtime PCR MasterMix kit (TOYOBO, Japan) on Eppendorf realplex.

Cyclophilin or HPRT mRNA were assayed as controls in real-time PCR assays.

The expression patterns of genes in the LRRII subfamily were assayed by quantitative Real-Time PCR (qRT-PCR) in various tomato tissues.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: