Sentence examples for basis of the coding from inspiring English sources

The codes and themes will form the basis of the coding strategy throughout data collection and the data analysis.

The Primers were designed on the basis of the coding sequences of the silkworm UGTs (see Additional file 1).

RT-PCR primers were designed on the basis of the coding sequences of the silkworm COEs (Additional file 5).

In cases where coding was different between the raters, the cases were discussed on the basis of the coding criteria and a consensus was reached.

The themes and sub-themes then formed the basis of the coding framework, which was refined through consultation with the other authors (CED and TKA).

The primers used for F. verticillioides were VER1 (CTTCCTGCGATGTTTCTCC) and VER2 (AATTGGCCATTGGTATTATATATCTA), which were designed by Mule et al. [ 25] on the basis of the coding sequence of the calmodulin gene; these primers amplify a DNA fragment of 587 bp.

With this change, an independent science of the history of canon law became necessary, in addition to the dogmatic canonical science of canon law on the basis of the code.

A simulated design of the selected structural models has been performed on the basis of the codes in force and the state of practice at the time of construction.

The necessity and importance of these works should be understood by the nation through retrofitting existing bridges against disasters and mitigating the unfavourable influence of bridge structures on the bridge environment on the basis of the code of ethics for civil engineers promulgated by JSCE.

The UK's Primark and Tesco, and C&A of the Netherlands, have also come on board, before a deadline set for 15 May - although the basis of the code was drawn up more than a year ago.

On the basis of the codes, subcategories were used as an intermediate stage to develop categories.