Sentence examples for basis of sequence alignments from inspiring English sources

Exact(11)

On the basis of sequence alignments framework residues in the murine antibody that are rare in human antibodies were identified and replaced with those usually found in structurally related human antibodies.

On the basis of sequence alignments, TDP1 proteins have a highly conserved TDP domain at the C-terminus and poorly conserved sequence identity at the N-terminus.

DEC-205 has been classified as a type I C-type lectin receptor on the basis of sequence alignments (East & Isacke, 2002).

On the basis of sequence alignments and phylogenetic analyses, which included a number of known stress-related NAC TFs from Arabidopsis and rice, we identified 50 new putative stress-related GmNAC genes.

The INS primers (forward: 5′GCAACTAGACGCAGCCCGCA′3; reverse: 5′GGCTTTATTCCATCTCTCTCGGTGC′3) were designed on the basis of sequence alignments of the INS region of human species and unrelated to the mouse; β-actin was the reference gene.

On the basis of sequence alignments, the canonical conserved residues could be identified in the wider epoxide hydrolase-like superfamily, the epoxide hydrolase family specifically, dehalogenases, and the annotated sequences from mammals, plants, fungi, and bacteria obtained after aligning BLAST results to the StEH1 sequence.

Show more...

Similar(49)

A total of 903 SNP sites in the eight genes flanking the four GWAS peaks were identified on the basis of sequence alignment.

The element shows a conserved function but without sufficient sequence conservation to be detected on the basis of sequence alignment, opening the possibility that other ancient invertebrate regulatory elements remain to be discovered.

On the basis of sequence alignment and chemical mapping experiments, the secondary structure surrounding the 3′ splice site has an internal loop, adenine bulge, and hairpin loop when it is in the hairpin conformation that exposes the 3′ splice site.

The modeling can be performed, either ab initio or by homology, on the basis of sequence alignment, chemical probing data and electron density maps derived by crystallography or cryo-electron microscopy.

Among these samples, 131 (10.6%; patient ages 1 132 months, median 12 months, mean 19 months) were positive for HBoV1, 5 (0.4%; patients 1 113 months of age, median 7.2 months, mean 29.2 months) for HBoV2, and 5 (0.4%; 1 108 months of age, median 12.0 months, mean 30.4 months) for HBoV3 on the basis of sequence alignment and phylogenetic analysis of PCR amplicons.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: