Your English writing platform
Discover LudwigSuggestions(5)
Exact(7)
A total of 903 SNP sites in the eight genes flanking the four GWAS peaks were identified on the basis of sequence alignment.
The modeling can be performed, either ab initio or by homology, on the basis of sequence alignment, chemical probing data and electron density maps derived by crystallography or cryo-electron microscopy.
The element shows a conserved function but without sufficient sequence conservation to be detected on the basis of sequence alignment, opening the possibility that other ancient invertebrate regulatory elements remain to be discovered.
On the basis of sequence alignment and chemical mapping experiments, the secondary structure surrounding the 3′ splice site has an internal loop, adenine bulge, and hairpin loop when it is in the hairpin conformation that exposes the 3′ splice site.
Threonine or serine embedded in the motif (T/S) XD is proposed to be the catalytic site on the basis of sequence alignment of PIN domains and it is located at residue-1390 (corresponding to threonine-231 in Figure 7) in hSMG6PINc.
As all families exhibit a high degree of primary structure conservation, the average amino acid identities ranging from 37%to87%7% among plant genomes, all SDRs sequences from Angiosperms can be analysed easily on the sole basis of sequence alignment, using very classical software (Blast, Multialin, ClustalW).
Similar(53)
Moreover, the S. ambofaciens genome contains several genes encoding homologues of CCRCs, albeit not clustered with the stambomycin biosynthetic genes and predicted on the basis of sequence alignments to be incapable of directing the production of pentyl- or hexylmalonyl-CoAs (Supplementary Fig. 1).
On the basis of sequence alignments framework residues in the murine antibody that are rare in human antibodies were identified and replaced with those usually found in structurally related human antibodies.
On the basis of sequence alignments, TDP1 proteins have a highly conserved TDP domain at the C-terminus and poorly conserved sequence identity at the N-terminus.
DEC-205 has been classified as a type I C-type lectin receptor on the basis of sequence alignments (East & Isacke, 2002).
The INS primers (forward: 5′GCAACTAGACGCAGCCCGCA′3; reverse: 5′GGCTTTATTCCATCTCTCTCGGTGC′3) were designed on the basis of sequence alignments of the INS region of human species and unrelated to the mouse; β-actin was the reference gene.
More suggestions(14)
basis of sequence control
basis of multisequence alignment
basis of sequence difference
basis of sequence orthology
basis of sequence recognition
basis of protein alignment
basis of sequence conservation
basis of sequence identity
basis of sequence characterisation
basis of sequence information
basis of sequence completeness
basis of sequence similarity
basis of sequence analysis
basis of sequence diversity
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com