Sentence examples for basis of preliminary sequences from inspiring English sources

Additional primers were designed on the basis of preliminary sequences to generate additional S segment coding region sequence (forward: HANSF3 5′-TGGATGTTAATTCCATCGA-3′ and reverse: HANSR4 5′-GATAATGTTTCGTGCTTTCA-3′; forward: HANF0001 TAGTAGTAGACTCCTTGAGAAGCTACT and reverse: HANTASR2 TAGTATGCTCCTTGARAAGC).

Proteins can be grouped into two sub-families (RIF_A and RIF_B) as recognised on the basis of preliminary genome sequencing data by Pizzi et al. [ 14] and recently confirmed by Joannin et al. on the complete repertoire of members [ 15].

On the basis of our preliminary sequencing data (∼1 million nucleotides) the library lacks of highly repeated sequences, therefore, the expected genome coverage (4.5×) is not degraded.

This S. pneumoniae NP358524 sequence has been tested as a pneumococcal vaccine antigen on the basis of preliminary screens for novel vaccine candidates [ 24].

The proposed rule allows hospitals to decide, "on the basis of preliminary information," whether a person is eligible for Medicaid.

The compounds were selected on the basis of preliminary virtual screening of approximately 480,000 drug-like small molecules from Chemical Diversity Laboratories.

The limits of each component were fixed on the basis of preliminary trials.

A gap size of 3 mm was selected for foams on the basis of preliminary studies.

The doses were selected on the basis of preliminary reports [ 16].

63 On the basis of preliminary work, we identified 46 potential predictor variables (see box 1).

The interview guide was designed on the basis of preliminary open interviews with three key informants.