Sentence examples for based upon the sequences from inspiring English sources

Exact(6)

The medians were calculated based upon the sequences showing the highest alignment scores.

The median was calculated based upon the sequences showing the highest alignment scores (see Methods section).

Primers for RT-PCR were designed with Software OLIGO 4.0 based upon the sequences of the genes corresponding to the identified spots on the chip.

The primers were designed based upon the sequences of the CcBV PTPs: each pair of primers is specific for each gene and enables the amplification of a DNA sequence encoding the 10 conserved motifs that characterize PTPs.

A phylogenetic reconstruction of the entire family, based upon the sequences of the ndhF and rbcL genes, partially confirmed previous results obtained by the analysis of the trnL-F and rps16 chloroplast regions [ 4].

In order to amplify the full-length AciHBGase II cDNA the F and R PCR primers were designed to encompass the 5′ and 3′ outermost regions of the AciHBGase II, based upon the sequences for the related AmHBGase II (HBGase IIF (5′ CAAAATG GAATTCTTTCGAGCGACGATAGTTA 3′) and AmHBGase IIR (5′ CGA GGTACCCAACCAGTCTACACCTTGCC 3′).

Similar(54)

Three of 225 patients (1%) received a matched therapy based upon the sequencing results.Conclusions: The practical application of molecular results to guide individual patient treatment is currently limited in patients with pancreatic adenocarcinoma.

Rodent oligonucleotide arrays are based upon the sequence of the B6 mouse or Brown-Norway (BN) rat strains.

Because our probes were designed based upon the sequence of the B73 reference genome [21], each exhibits a perfect match to B73.

Based upon the sequence similarity searches, we found Vitis to have the greatest number of hits to contigs from both species.

Therefore, based upon the sequence identity between these genes, we designed a consensus oligonucleotide primer, T3con2, that would be suitable for the identification of the region containing the initiator methionine of the TACC3 cDNAs from primates and rodents.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: