Sentence examples for based upon the sequences from inspiring English sources
The medians were calculated based upon the sequences showing the highest alignment scores.
The median was calculated based upon the sequences showing the highest alignment scores (see Methods section).
Primers for RT-PCR were designed with Software OLIGO 4.0 based upon the sequences of the genes corresponding to the identified spots on the chip.
The primers were designed based upon the sequences of the CcBV PTPs: each pair of primers is specific for each gene and enables the amplification of a DNA sequence encoding the 10 conserved motifs that characterize PTPs.
A phylogenetic reconstruction of the entire family, based upon the sequences of the ndhF and rbcL genes, partially confirmed previous results obtained by the analysis of the trnL-F and rps16 chloroplast regions [ 4].
In order to amplify the full-length AciHBGase II cDNA the F and R PCR primers were designed to encompass the 5′ and 3′ outermost regions of the AciHBGase II, based upon the sequences for the related AmHBGase II (HBGase IIF (5′ CAAAATG GAATTCTTTCGAGCGACGATAGTTA 3′) and AmHBGase IIR (5′ CGA GGTACCCAACCAGTCTACACCTTGCC 3′).
Three of 225 patients (1%) received a matched therapy based upon the sequencing results.Conclusions: The practical application of molecular results to guide individual patient treatment is currently limited in patients with pancreatic adenocarcinoma.
Because our probes were designed based upon the sequence of the B73 reference genome [21], each exhibits a perfect match to B73.
Based upon the sequence similarity searches, we found Vitis to have the greatest number of hits to contigs from both species.
Therefore, based upon the sequence identity between these genes, we designed a consensus oligonucleotide primer, T3con2, that would be suitable for the identification of the region containing the initiator methionine of the TACC3 cDNAs from primates and rodents.
