Sentence examples for based on their short from inspiring English sources

However, filaments that appear to still be in the process of growing (based on their short and relatively uniform lengths) have never been observed in oocytes that have clearly progressed into prometaphase.

Based on their short size, (generally less than 1,000 bp), these events would be classified as gene conversions in most systems [ 31].

However, for NMR analysis, protein interference is often alleviated by suppressing their signals based on their short T2 relaxation times using the Carr Purcell Meiboom Gill (CPMG) experiment.

Another problem is this technique's complicated joining reaction in which a promoter cassette, the purified V gene fragment and a terminator cassette must be assembled in a specific order based on their short homology overlaps.

The estimation of site-specific rates was determined using the tree obtained with the concatenated datasets except that the branching order between the three main rodent clades (E, G and H in Figure 1) were specified as a trifurcation based on their short lengths.

A short list: Stop making big regulatory decisions with long-term consequences based on their short-term effect on stock prices.

And federal regulators might be willing to approve other prevention drugs based on their short-term effects on biomarkers, speeding the conduct of clinical trials.

Isolated bacterial cultures (169 isolates) were grouped into different genera based on their short-length sequencing of 16S rDNA with 895F (CRCCTGGGGAGTRCRG), 47F (GCGCCAGGGAATTCTAAAAC) and 783R (ACCMGGGTATCTAATCCKG) primers.

Conclusions about the performance of eco-feedback systems in the literature were mostly drawn based on their short-term performance, during which eco-feedback information was continuously provided.

The model is designed to identify the effects of demand responsiveness to the fluctuations of spot prices, based on their short-term price elasticities.

Regression to the mean is the tendency of individual children selected based on their shorter or taller heights than that of the population to have heights closer to the mean when they are measured a second time.