Sentence examples for based on the precarious from inspiring English sources
Using primers based on the Precarious Point virus sequence, N and NS-s gene sequences were obtained from the rockhopper penguin-associated virus (EU274384).
The additional wage rate is based on the bonus for precarious work (temporary and subcontracted labour) on the French labour market [55, 56].
The close of the second world war ushered in a cold war, with a precarious peace based on the threat of mutually assured destruction.
It is also demonstrated that while the finite element method is utilized for analyzing slope stability, the critical slip lines based on the overloading definition might be for the most part shallower than those by the strength reserving definition and the conventional limit equilibrium methods, and hence the design based on the overloading definition might be precarious.
Using a primer, containing a 3'-terminus based on the conserved RNA segment termini of Uukuniemi virus, clones containing N (EU274386) and NS-s gene (EU274385) sequences of the S RNA segment of Precarious Point virus [3] were obtained.
based on the randomization sequence.
Answer based on the reading.
Following the event, a field survey was conducted along the fault zone with the goal of estimating the peak ground acceleration of the shock based on visually evaluating precarious rock formations and other indicators.
The primer sequences for the phlebovirus were based on sequence from Precarious Point virus and were forward 5' GGCAGATGATGGACAGTGG 3' and reverse 5' GTCTGAGGAAGGCAAGAAGG 3' (annealing temperature 55°C).
I understand the precarious nature of voting based on one issue, but, as I said, I have pretty much always put my concern for equal rights and opportunities for all above all other election issues to a certain extent.
