We constructed novel gene cassettes for BGL1 display with the S. cerevisiae CWP2 promoter and/or its anchoring region based on the SS cassette (Additional file 1).
In most of the papers the comparison of both methods was based on the expression cassette containing some marker or reporter transgenes.
If a novel cassette is identified by a reviewer, they will e-mail the submitter suggesting a name based on the most similar cassette family and the next available number.
Targeted allele: forward primer derived from exon 3 (m1-U3, AGATGGATGACGCCACAAG) and a reverse primer based on the PGK-Neo cassette (neofwd, CTTCTATCGCCTTCTTGACG) amplified a 600 bp fragment.
Mutants were constructed using an insertional mutagenesis strategy (Davis et al., 2002) based on the UAU1 marker cassette (Enloe et al., 2000).
Because the ability of SP cells to efflux out of cells is based on the ATP-binding cassette (ABC) subfamily G, member 2 (ABCG2), the low expression of ABCG2 in CSCs may be responsible for the sparse SP in the EBV-associated NPC cell line.
Out of 78 HMP contigs with CRISPR cassettes, 48 were assigned with taxonomic labels based on the taxonomy of cassette-flanking regions, and for six contigs the taxonomic assignment could be made according to protospacers.
To expand the toolbox for genomic modifications, we designed a strategy based on the Cre/loxP-based Recombinase-Mediated Cassette Exchange (RMCE) system for functional genomics analyses.
The homology model of the SUR1 NBD1 and NBD2 dimer [ 17], based on the prokaryotic ATP-binding cassette (ABC) protein crystal structure of MJ0796 (PDB accession # 1F30) was generously provided by Dr C.G. Nichols (Washington University, St . Louis MO) and was used to visualize and predict the location and interactions of key regions and residues in the NBD1/2 dimer using Pymol software [ 17].
In this paper we analyze the pumping efficiency of a generic 3D DEMO divertor configuration based on the size of inter-cassette gaps.
