Sentence examples for based on the aes from inspiring English sources

Based on the AES cut off score of 38, 23 patients were classified in the PD-A group and 25 were classified in the PD-NA group.

The evaluation of the treatment safety was based on the AEs reported during the study and numbers and percentages were presented for the pooled data.

Based on the AE energy released during these events and the locations of the events, FPZ size is obtained.

Based on the AE-C data a model is presented that described the light ion ratio in terms of latitude for day and night conditions.

Reasonable selection of the location of the measuring point; To determine that the test point is in the tensile fracture zone or compressive shear failure zone; Based on the AE counts, determine whether the partition is reasonable: This is mainly based on the number of the acoustic emission counts and the frequency of occurrence to determine the partition is reasonable.

Transcript description was based on the Ae. aegypti protein database AegyXcel [ 27].

We describe here the assembly of Ae. tauschii BACs into contigs and their ordering based on the Ae. tauschii comparative genetic map [ 11].

Function parent attribution of the sequenced transcripts is based on the Ae. aegypti database AegyXcel (http://exon.niaid.nih.gov/transcriptome.html aegyxcel).html aegyxcel

Based on the Ae. aegypti trapping data, it was assumed rainfall was the main driver of the availability of larval habitats, and thus adult population densities.

Based on the Ae. tauschii sequence we designed primers (SBEIIb_F1: TGAAGACACGAGCAGAATGG, SBEIIb_R1: CCAAGTCTTTTAATTCTTGGAAGC) to amplify the region surrounding the glycogen branching enzyme domain (cd02854 5) (exons 5 9) in the SBE positive clones.

Four contigs were assigned to the short arm and two to the long arm of chromosome 7D, as expected based on the Ae. tauschii genetic map (Supplementary Table S8).