Sentence examples for based on sequences from from inspiring English sources

Exact(50)

The ~10,000 SNPs that were provided as part of the genotyping platform by Parallele Bio Sciences were discovered using the cattle genome project, based on sequences from only one or a few animals (information regarding their discovery is at ).

The alternative primer PLA491F was designed and has been tested to amplify all known algal plastids based on sequences from cultures [8], although it has one or more mismatches at the 5' end with several algal classes (Figure S1).

As reported online today in Nature, they first designed several siRNAs based on sequences from the HSV-2 genome.

Therefore, this article presents a quantitative real-time RT-PCR assay based on sequences from Europe and Africa.

This improved method includes a pair of primers based on sequences from histidine decarboxylases from Gram-negative bacteria.

Several amplification reactions were performed with degenerative primers that were designed based on sequences from the orthologous genes available in other species.

Show more...

Similar(10)

The primer sequences for the phlebovirus were based on sequence from Precarious Point virus and were forward 5' GGCAGATGATGGACAGTGG 3' and reverse 5' GTCTGAGGAAGGCAAGAAGG 3' (annealing temperature 55°C).

SNPs were selected based on sequence from individual founder colonies, and were tested only within the same founder colony.

Consequently, assignment of sequence haplotypes to individual sub-genomes can be attempted based on sequence from diploid progenitors, but only to a limited extent.

Here we produce a Δ11 desaturase gene genealogy within ECB, based on sequence from the two putative functional genes found in Xue et al. [ 25].

Based on sequence from the polymerase and capsid, 61 of these viruses (95%) closely clustered with genogroup II4 (≥90% similarity with prototype Lorsdale strain).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: