Sentence examples for based on sequence from from inspiring English sources
The primer sequences for the phlebovirus were based on sequence from Precarious Point virus and were forward 5' GGCAGATGATGGACAGTGG 3' and reverse 5' GTCTGAGGAAGGCAAGAAGG 3' (annealing temperature 55°C).
SNPs were selected based on sequence from individual founder colonies, and were tested only within the same founder colony.
Here we produce a Δ11 desaturase gene genealogy within ECB, based on sequence from the two putative functional genes found in Xue et al. [ 25].
Consequently, assignment of sequence haplotypes to individual sub-genomes can be attempted based on sequence from diploid progenitors, but only to a limited extent.
Based on sequence from the polymerase and capsid, 61 of these viruses (95%) closely clustered with genogroup II4 (≥90% similarity with prototype Lorsdale strain).
For RT-PCR of the FT-like gene, the primer-probe combination was designed by Applied Biosystems Custom Taqman(R) Gene Expression Assay Service based on sequence from the genomic clone: reverse primer GCTGGTCTTGGACTCTCATACC, forward primer GGTGACTGATATTCCAGCAACTACT, and probe TCTCTTGCCCATAGCTTG.
The ~10,000 SNPs that were provided as part of the genotyping platform by Parallele Bio Sciences were discovered using the cattle genome project, based on sequences from only one or a few animals (information regarding their discovery is at ).
The alternative primer PLA491F was designed and has been tested to amplify all known algal plastids based on sequences from cultures [8], although it has one or more mismatches at the 5' end with several algal classes (Figure S1).
This improved method includes a pair of primers based on sequences from histidine decarboxylases from Gram-negative bacteria.
Several amplification reactions were performed with degenerative primers that were designed based on sequences from the orthologous genes available in other species.
